Display Settings:

Format

Send to:

Choose Destination
Pr012786479

STS probe D15S823 for aryl hydrocarbon receptor nuclear translocator 2 (ARNT2) and 3 more genes

Synopsis

Field NameValues
NameD15S823
AliasesCHLC.GATA89D04; CHLC.GATA89D04.P32107; GATA-P32107; GATA89D04; RH30216; RH3847; RH54374; SHGC-17611
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesARNT2; ARNT2; ARNT2; ARNT2
UniSTS IDUniSTS:53519

Sequences

>Probe|12786479|PRIMERF Forward PCR primer (outermost) (20b)
GGCTTTGCATCCAGAATTTA
>Probe|12786479|PRIMERR Reverse PCR primer (outermost) (20b)
CACTTCCAACATTGAGGGTC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3152879 cr10000SHGC-17611
Homo sapienslinkageRutgers Map15 cmD15S823
Homo sapiensradiation hybridNCBI RH15540.6 crSHGC-17611
Homo sapiensradiation hybridWhitehead-RH15307.4 cr3000CHLC.GATA89D04

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID53519
Probe Cross-refcontext specific help for: Probe Cross-refGDB:685869
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk