Display Settings:

Format

Send to:

Choose Destination
Pr012782205

STS probe Frmd7 for FERM domain containing 7 (Frmd7) and 1 more gene

Synopsis

Field NameValues
NameFrmd7
TypeSTS
Application
Source organism
Source sequence
Target genesFRMD7; Frmd7
UniSTS IDUniSTS:531214

Sequences

>Probe|12782205|PRIMERF Forward PCR primer (outermost) (21b)
ATGCAAGGCTTTCTGGAAGAC
>Probe|12782205|PRIMERR Reverse PCR primer (outermost) (21b)
CGGAAACTGGAACCTTTGCTA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:4822436
UniSTS IDcontext specific help for: UniSTS ID531214
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk