Display Settings:

Format

Send to:

Choose Destination
Pr012781910

STS probe STS-X16832 for cathepsin H (CTSH) and 4 more genes

Synopsis

Field NameValues
NameSTS-X16832
AliasesRH39592; sts-X16832
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100460564; CTSH; CTSH; CTSH; CTSH
UniSTS IDUniSTS:53095

Sequences

>Probe|12781910|PRIMERF Forward PCR primer (outermost) (16b)
GGCCTGGGTGGAAATC
>Probe|12781910|PRIMERR Reverse PCR primer (outermost) (20b)
GGAAAGTAGCCCTTCTGGAC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415274.78 cr3000sts-X16832
Homo sapienslinkageRutgers Map15 cmSTS-X16832
Homo sapiensradiation hybridNCBI RH15521.8 crsts-X16832

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID53095
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk