Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012781534

Eukaryota (3 taxa) STS probe Rnu2 for radial spoke head 10 homolog B (Chlamydomonas) (rsph10b) and 3 more genes

Synopsis

Field NameValues
NameRnu2
AliasesRnu2-10
TypeSTS
Application
Source organism
Source sequence
Target organismsAnolis carolinensis; Oreochromis niloticus; Sus scrofa
Target genesrsph10b (Anolis carolinensis); LOC100697162 (Oreochromis niloticus); LOC100709077 (Oreochromis niloticus); LOC100737786 (Sus scrofa)

Sequences

>Probe|12781534|PRIMERF Forward PCR primer (outermost) (20b)
CTCGGCCTTTTGGCTAAGAT
>Probe|12781534|PRIMERR Reverse PCR primer (outermost) (20b)
CGTTCCTGGAGGTACTGCAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:4442077
UniSTS IDcontext specific help for: UniSTS ID530590
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk