Display Settings:

Format

Send to:

Choose Destination
Pr012779933

Eukaryota (3 taxa) STS probe AL008894 for X-linked inhibitor of apoptosis, E3 ubiquitin protein ligase (XIAP) and 2 more genes

Synopsis

Field NameValues
NameAL008894
AliasesDJ167P19T7; stSG20774
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesXIAP (Pongo abelii); XIAP (Homo sapiens); XIAP (Pan troglodytes)
UniSTS IDUniSTS:52915

Sequences

>Probe|12779933|PRIMERF Forward PCR primer (outermost) (20b)
GGCCACGTTCTGTCTCTCTC
>Probe|12779933|PRIMERR Reverse PCR primer (outermost) (20b)
AGGCCTCCTGGAGGAAATTA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL008894

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID52915
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk