Display Settings:

Format

Send to:

Choose Destination
Pr012778295

STS probe D2S2719 for v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN) and 3 more genes

Synopsis

Field NameValues
NameD2S2719
AliasesUTR-00900; WI-7056
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMYCN; MYCN; MYCN; MYCN
UniSTS IDUniSTS:52755

Sequences

>Probe|12778295|PRIMERF Forward PCR primer (outermost) (20b)
GGCAGTAGGACCACCAGTGT
>Probe|12778295|PRIMERR Reverse PCR primer (outermost) (20b)
CTAATACTGGCCGCAAAAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S2719

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID52755
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678977
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk