Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012774397

Eukaryota (8 taxa) STS probe G15966 for ZFP36 ring finger protein-like 1 (ZFP36L1) and 12 more genes

Synopsis

Field NameValues
NameG15966
AliasesCHLC.UTR_04914_X79067; CHLC.UTR_04914_X79067.P65585
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus; Nomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pongo abelii; Homo sapiens; Equus caballus
Target genesZFP36L1 (Equus caballus); LOC100134372 (Homo sapiens); ZFP36L1 (Pongo abelii); LOC100289418 (Homo sapiens); ZFP36L1 (Callithrix jacchus); LOC100406009 (Callithrix jacchus); LOC100448718 (Pongo abelii); ZFP36L1 (Nomascus leucogenys); Zfp36l1 (Mus musculus); Zfp36l1 (Rattus norvegicus); ZFP36L1 (Homo sapiens); LOC714309 (Macaca mulatta); LOC722674 (Macaca mulatta)

Sequences

>Probe|12774397|PRIMERF Forward PCR primer (outermost) (20b)
GGATTCCAGGTCTGGAGTTT
>Probe|12774397|PRIMERR Reverse PCR primer (outermost) (20b)
GTTTCTTGAAAAAACGGGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmG15966

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID52394
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5503426
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk