Display Settings:

Format

Send to:

Choose Destination
Pr012769964

STS probe D7S1812 for solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13) and 3 more genes

Synopsis

Field NameValues
NameD7S1812
AliasesATA-D7S1812; ATA19D05; CHLC.ATA19D05; CHLC.ATA19D05.P16294; sWSS2685
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC25A13; SLC25A13; CYCSP18; SLC25A13
UniSTS IDUniSTS:51995

Sequences

>Probe|12769964|PRIMERF Forward PCR primer (outermost) (23b)
GGAGGAAGGTGGATAATAATAGG
>Probe|12769964|PRIMERR Reverse PCR primer (outermost) (20b)
AATGTCACAAGGGTGCAGAT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmD7S1812
Homo sapienslinkageMarshfield7109.12 cmATA19D05

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID51995
Probe Cross-refcontext specific help for: Probe Cross-refGDB:683712
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk