Display Settings:

Format

Send to:

Choose Destination
Pr012768025

Homo sapiens STS probe D7S1790

Synopsis

Field NameValues
NameD7S1790
AliasesATA-D7S1790; ATA1A10; CHLC.31877; CHLC.ATA1A10; CHLC.ATA1A10.31877; CHLC.ATA1A10.P10202; RH83624; SHGC-4300
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:51820

Sequences

>Probe|12768025|PRIMERF Forward PCR primer (outermost) (20b)
GGAGAAGGAGGGAGGGATAG
>Probe|12768025|PRIMERR Reverse PCR primer (outermost) (20b)
ACAAAAAGTTGCAATCCCTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G37373 cr10000SHGC-4300
Homo sapienslinkageMarshfield717.17 cmATA1A10
Homo sapiensradiation hybridNCBI RH7172.6 crSHGC-4300

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:683742
UniSTS IDcontext specific help for: UniSTS ID51820
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk