Display Settings:

Format

Send to:

Choose Destination
Pr012766146

Mus musculus STS probe Myb for myeloblastosis oncogene (Myb)

Synopsis

Field NameValues
NameMyb
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneMyb (Mus musculus)
UniSTS IDUniSTS:516504

Sequences

>Probe|12766146|PRIMERF Forward PCR primer (outermost) (20b)
TTCAAGGCCAGCATTCTTGC
>Probe|12766146|PRIMERR Reverse PCR primer (outermost) (20b)
CCTCTAGGAGCTCATTTGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3799084
UniSTS IDcontext specific help for: UniSTS ID516504
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk