Display Settings:

Format

Send to:

Choose Destination
Pr012763777

Homo sapiens STS probe D22S604

Synopsis

Field NameValues
NameD22S604
AliasesAC22-299; PH518; RH5274; RH57797; WI-299
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:51437

Sequences

>Probe|12763777|PRIMERF Forward PCR primer (outermost) (20b)
GGAAGTGGTGGACCTCAGAT
>Probe|12763777|PRIMERR Reverse PCR primer (outermost) (23b)
TTAACTCACCTTTGAGTCTCAGC

References

1.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S604
Homo sapiensradiation hybridWhitehead-RH2263.9 cr3000WI-299

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID51437
Probe Cross-refcontext specific help for: Probe Cross-refGDB:335972
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk