Display Settings:

Format

Send to:

Choose Destination
Pr012761088

STS probe STS-H59437 for rabaptin, RAB GTPase binding effector protein 1 (RABEP1) and 5 more genes

Synopsis

Field NameValues
NameSTS-H59437
AliasesRH39319; sts-H59437
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRABEP1; RABEP1; RABEP1; RABEP1; NUP88; RABEP1
UniSTS IDUniSTS:51195

Sequences

>Probe|12761088|PRIMERF Forward PCR primer (outermost) (20b)
GGAAATGTGTTCCGAAAATC
>Probe|12761088|PRIMERR Reverse PCR primer (outermost) (19b)
CCCCAGAGACCTTCAAATG

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41743.17 cr3000sts-H59437
Homo sapienslinkageRutgers Map17 cmSTS-H59437

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID51195
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk