Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012757980

Eukaryota (6 taxa) STS probe D10S568 for protein kinase, cGMP-dependent, type I (PRKG1) and 5 more genes

Synopsis

Field NameValues
NameD10S568
AliasesAFM265vd9; RH1099; RH13030; SHGC-2024; stSG1017
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesPRKG1 (Callithrix jacchus); PRKG1 (Pongo abelii); PRKG1 (Nomascus leucogenys); PRKG1 (Homo sapiens); PRKG1 (Macaca mulatta); PRKG1 (Pan troglodytes)

Sequences

>Probe|12757980|PRIMERF Forward PCR primer (outermost) (20b)
GCTTTATTTGCCCATTCTCT
>Probe|12757980|PRIMERR Reverse PCR primer (outermost) (22b)
TGTAGTATTTTGAGGTCAAGGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3102569 cr10000SHGC-2024
Homo sapiensradiation hybridGeneMap99-G3102545 cr10000AFM265vd9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50915
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk