Display Settings:

Format

Send to:

Choose Destination
Pr012756127

STS probe SHGC-12505 for calcium channel, voltage-dependent, gamma subunit 1 (CACNG1) and 4 more genes

Synopsis

Field NameValues
NameSHGC-12505
AliasesCACNLG; RH13965; UTR-03632; WI-7259; WIAF-411; WIAF-412
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCACNG1; CACNG1; LOC718591; CACNG1; CACNG1
UniSTS IDUniSTS:50748

Sequences

>Probe|12756127|PRIMERF Forward PCR primer (outermost) (18b)
GCTTCTTCCCCAGGAAGC
>Probe|12756127|PRIMERR Reverse PCR primer (outermost) (20b)
AGGTTGTCCCTGCAATGTTC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3172888 cr10000SHGC-12505
Homo sapiensradiation hybridGeneMap99-G3173389 cr10000SHGC-12505
Homo sapienslinkageRutgers Map17 cmSHGC-12505
Homo sapiensradiation hybridNCBI RH17705.3 crSHGC-12505

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50748
Probe Cross-refcontext specific help for: Probe Cross-refGDB:679090
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk