Display Settings:

Format

Send to:

Choose Destination
Pr012753378

Eukaryota (4 taxa) STS probe RH48521 for ATPase, class II, type 9A (ATP9A) and 7 more genes

Synopsis

Field NameValues
NameRH48521
AliasesstSG30368
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pongo abelii; Homo sapiens
Target genesLOC100424157 (Macaca mulatta); LOC100426478 (Macaca mulatta); LOC100451570 (Pongo abelii); ATP9A (Pongo abelii); ATP9A (Nomascus leucogenys); ATP9A (Homo sapiens); LOC653502 (Homo sapiens); LOC654090 (Homo sapiens)
UniSTS IDUniSTS:50500

Sequences

>Probe|12753378|PRIMERF Forward PCR primer (outermost) (21b)
GCTGTGAGTTTTGCTTTCAGG
>Probe|12753378|PRIMERR Reverse PCR primer (outermost) (20b)
CATTGACACTGTCACCTGGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB420301.64 cr3000stSG30368
Homo sapienslinkageRutgers Map20 cmRH48521
Homo sapiensradiation hybridNCBI RH20513.3 crstSG30368

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50500
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk