Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012752634

Eukaryota (4 taxa) STS probe RH71206 for MLX, MAX dimerization protein (MLX) and 9 more genes

Synopsis

Field NameValues
NameRH71206
AliasesstSG38762
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesMLX (Pongo abelii); LOC100287926 (Homo sapiens); LOC100429064 (Macaca mulatta); COASY (Pongo abelii); COASY (Pan troglodytes); MLX (Pan troglodytes); MLX (Homo sapiens); COASY (Macaca mulatta); MLX (Macaca mulatta); COASY (Homo sapiens)

Sequences

>Probe|12752634|PRIMERF Forward PCR primer (outermost) (20b)
GCTGGTATTTGGCCAACACT
>Probe|12752634|PRIMERR Reverse PCR primer (outermost) (21b)
TACAGGTTCCAGTATTTGCGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB417305.9 cr3000stSG38762
Homo sapienslinkageRutgers Map17 cmRH71206
Homo sapiensradiation hybridNCBI RH17352.4 crstSG38762

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50433
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk