Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012751084

Eukaryota (5 taxa) STS probe D4S1563 for HECT and RLD domain containing E3 ubiquitin protein ligase 3 (HERC3) and 4 more genes

Synopsis

Field NameValues
NameD4S1563
AliasesAFM248vf1; HS248VF1; RH74456; stSG34767
TypeSTS
Application
Source organism
Source sequence
Target organismsCallithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesHERC3 (Callithrix jacchus); HERC3 (Pongo abelii); HERC3 (Pan troglodytes); HERC3 (Macaca mulatta); HERC3 (Homo sapiens)

Sequences

>Probe|12751084|PRIMERF Forward PCR primer (outermost) (17b)
GCTGCCTGACACACTGG
>Probe|12751084|PRIMERR Reverse PCR primer (outermost) (20b)
ACTATTGCTGTTGCTGACCC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 5 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

5.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB44461.5 cr3000AFM248vf1
Homo sapienslinkageRutgers Map4 cmD4S1563
Homo sapienslinkageMarshfield497.3 cmAFM248vf1
Homo sapienslinkagedeCODE496.96 cmD4S1563
Homo sapienslinkageGenethon495.7 cmAFM248vf1
Homo sapiensradiation hybridNCBI RH41059.3 crAFM248vf1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID50293
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199535
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk