Display Settings:

Format

Send to:

Choose Destination
Pr012746816

STS probe G34842 for S100 calcium binding protein A10 (S100A10) and 4 more genes

Synopsis

Field NameValues
NameG34842
AliasSHGC-52317
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesS100A10; S100A10; S100A10; S100A10; S100A10
UniSTS IDUniSTS:49881

Sequences

>Probe|12746816|PRIMERF Forward PCR primer (outermost) (22b)
GCTCATGAAATCCTTCTATGGG
>Probe|12746816|PRIMERR Reverse PCR primer (outermost) (22b)
AGCAGAAGGGAAAGAAGTAGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmG34842

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID49881
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk