Display Settings:

Format

Send to:

Choose Destination
Pr012746504

STS probe Ndufb11

Synopsis

Field NameValues
NameNdufb11
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:498527

Sequences

>Probe|12746504|PRIMERF Forward PCR primer (outermost) (22b)
TCGAGCGGCCGCCCGGGCAGGT
>Probe|12746504|PRIMERR Reverse PCR primer (outermost) (20b)
AGCGTGGTCGCGGCCGAGGT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3698120
UniSTS IDcontext specific help for: UniSTS ID498527
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk