Display Settings:

Format

Send to:

Choose Destination
Pr012746228

STS probe Rgs10 for regulator of G-protein signalling 10 (Rgs10)

Synopsis

Field NameValues
NameRgs10
TypeSTS
Application
Source organism
Source sequence
Target geneRgs10
UniSTS IDUniSTS:498276

Sequences

>Probe|12746228|PRIMERF Forward PCR primer (outermost) (20b)
CAAGCGAACTGAGGAAGAGG
>Probe|12746228|PRIMERR Reverse PCR primer (outermost) (20b)
TTGAAAGGCTGAGTGTCCAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3690982
UniSTS IDcontext specific help for: UniSTS ID498276
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk