Display Settings:

Format

Send to:

Choose Destination
Pr012744488

STS probe Gng7 for guanine nucleotide binding protein (G protein), gamma 7 (Gng7) and 1 more gene

Synopsis

Field NameValues
NameGng7
AliasesUniSTS:496688
TypeSTS
Application
Source organism
Source sequence
Target genesGng7; Gng7
UniSTS IDUniSTS:496688

Sequences

>Probe|12744488|PRIMERF Forward PCR primer (outermost) (22b)
ATGTCAGGTACTAACAACGTCG
>Probe|12744488|PRIMERR Reverse PCR primer (outermost) (21b)
CTAGAGAATTATGCAAGGCTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk