Display Settings:

Format

Send to:

Choose Destination
Pr012743691

Mus musculus STS probe Xcr1 for chemokine (C motif) receptor 1 (Xcr1)

Synopsis

Field NameValues
NameXcr1
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneXcr1 (Mus musculus)
UniSTS IDUniSTS:495959

Sequences

>Probe|12743691|PRIMERF Forward PCR primer (outermost) (20b)
CTTTGTTTCGCACAAGGTCC
>Probe|12743691|PRIMERR Reverse PCR primer (outermost) (20b)
AAGAGTGTGAGGTTGTAGGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3624855
UniSTS IDcontext specific help for: UniSTS ID495959
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk