Display Settings:

Format

Send to:

Choose Destination
Pr012743667

STS probe B3gnt3 for UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 (B3gnt3)

Synopsis

Field NameValues
NameB3gnt3
TypeSTS
Application
Source organism
Source sequence
Target geneB3gnt3
UniSTS IDUniSTS:495937

Sequences

>Probe|12743667|PRIMERF Forward PCR primer (outermost) (20b)
CTGGAAGCGCAGAAATACGG
>Probe|12743667|PRIMERR Reverse PCR primer (outermost) (20b)
ACGAAGCTGGCGTTGGTACA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3624737
UniSTS IDcontext specific help for: UniSTS ID495937
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk