Display Settings:

Format

Send to:

Choose Destination
Pr012743164

STS probe RH37467 for parkin RBR E3 ubiquitin protein ligase (PARK2)

Synopsis

Field NameValues
NameRH37467
AliasesSC6PA6G10; sc6pa6g10; stSG10653
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePARK2
UniSTS IDUniSTS:49230

Sequences

>Probe|12743164|PRIMERF Forward PCR primer (outermost) (22b)
GCCTTCTTTTCAATGCTCTACC
>Probe|12743164|PRIMERR Reverse PCR primer (outermost) (18b)
ATTGGGGAGAAACGTGGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB46628.21 cr3000sc6pa6g10
Homo sapienslinkageRutgers Map6 cmRH37467
Homo sapiensradiation hybridNCBI RH61631.6 crsc6pa6g10

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID49230
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk