Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr031779197

Eukaryota (3 taxa) STS probe UniSTS:488585 for histone cluster 1, H4m (Hist1h4m) and 12 more genes

Synopsis

Field NameValues
NameUniSTS:488585
TypeSTS
Application
Source organism
Source sequence
Target organismsRattus norvegicus; Sus scrofa; Bos taurus
Target genesLOC100154071 (Sus scrofa); LOC100155732 (Sus scrofa); LOC100156932 (Sus scrofa); LOC100294773 (Bos taurus); LOC100623163 (Sus scrofa); LOC100623548 (Sus scrofa); LOC100910554 (Rattus norvegicus); Hist1h4m (Rattus norvegicus); HIST1H2AD (Bos taurus); HIST1H2BI (Bos taurus); HIST1H2AG (Bos taurus); Hist1h2bcl1 (Rattus norvegicus); LOC682558 (Rattus norvegicus)

Sequences

>Probe|31779197|PRIMERF Forward PCR primer (outermost) (26b)
ATGCCTGAGCCTGCTAAGTCCGCTCC
>Probe|31779197|PRIMERR Reverse PCR primer (outermost) (24b)
TCACTTGGAGCTGGTGTACTTGGT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5505660
UniSTS IDcontext specific help for: UniSTS ID488585
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk