Display Settings:

Format

Send to:

Choose Destination
Pr031817811

STS probe UniSTS:486421

Synopsis

Field NameValues
NameUniSTS:486421
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:486421

Sequences

>Probe|31817811|PRIMERF Forward PCR primer (outermost) (20b)
GGGGTGGAGGAGCCTTAGTG
>Probe|31817811|PRIMERR Reverse PCR primer (outermost) (20b)
GGCAGGGTGGTGGTGGTAAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID486421
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk