Display Settings:

Format

Send to:

Choose Destination
Pr012742392

STS probe D11S4573 for leucine rich repeat containing 4C (LRRC4C) and 1 more gene

Synopsis

Field NameValues
NameD11S4573
AliasesRH35124; SHGC-8206
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLRRC4C; LRRC4C
UniSTS IDUniSTS:48534

Sequences

>Probe|12742392|PRIMERF Forward PCR primer (outermost) (21b)
GCCATCAAGTTCGTAGTCCAA
>Probe|12742392|PRIMERR Reverse PCR primer (outermost) (21b)
CACTTCCTGGTTAATTTGGCA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3111839 cr10000SHGC-8206
Homo sapienslinkageRutgers Map11 cmD11S4573
Homo sapiensradiation hybridNCBI RH11257.1 crSHGC-8206

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID48534
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740213
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk