Display Settings:

Format

Send to:

Choose Destination
Pr012742322

STS probe D1S1624 for disrupted in schizophrenia 2 (non-protein coding) (DISC2) and 6 more genes

Synopsis

Field NameValues
NameD1S1624
AliasesCHLC.ATA22C02; CHLC.ATA22C02.P15714
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTSNAX-DISC1; LOC100453374; DISC1; DISC2; DISC1; DISC1; DISC1
UniSTS IDUniSTS:48471

Sequences

>Probe|12742322|PRIMERF Forward PCR primer (outermost) (20b)
GCCAGGGAAAATAATCCAGT
>Probe|12742322|PRIMERR Reverse PCR primer (outermost) (23b)
TTTCTCACCTTTAAATGTCATCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmD1S1624

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID48471
Probe Cross-refcontext specific help for: Probe Cross-refGDB:364961
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk