Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012741478

Macaca mulatta and Nomascus leucogenys STS probe UniSTS:480097 for potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia) (KCNA1) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:480097
AliasesAB063024
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Homo sapiens
Target genesLOC100586756 (Nomascus leucogenys); KCNA1 (Macaca mulatta)

Sequences

>Probe|12741478|PRIMERF Forward PCR primer (outermost) (20b)
CTCCTCTCCAAACCTTGCAG
>Probe|12741478|PRIMERR Reverse PCR primer (outermost) (19b)
GGCATGTCACATGGAGTCC

References

1.

A rhesus macaque radiation hybrid map and comparative analysis with the human genome.

Murphy WJ, Agarwala R, Schäffer AA, Stephens R, Smith C Jr, Crumpler NJ, David VA, O'Brien SJ.

Genomics. 2005 Oct;86(4):383-95.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmUniSTS:480097
Macaca mulattaradiation hybridRH1143.5 crAB063024

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID480097
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk