Display Settings:

Format

Send to:

Choose Destination
Pr012741204

Eukaryota (3 taxa) STS probe D14S121 for A kinase (PRKA) anchor protein 6 (AKAP6) and 2 more genes

Synopsis

Field NameValues
NameD14S121
AliasesHUMUT1289; RH34194; RH95410; SHGC-4864; UT1289
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesAKAP6 (Pongo abelii); AKAP6 (Pan troglodytes); AKAP6 (Homo sapiens)
UniSTS IDUniSTS:47985

Sequences

>Probe|12741204|PRIMERF Forward PCR primer (outermost) (20b)
GCATGATTGACTGATAGATA
>Probe|12741204|PRIMERR Reverse PCR primer (outermost) (19b)
GTAGTTTGGTGTTTTGGTA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G314854 cr10000SHGC-4864
Homo sapiensradiation hybridTNG146512 cr50000SHGC-4864
Homo sapienslinkageRutgers Map14 cmD14S121
Homo sapienslinkageMarshfield1434.43 cmUT1289
Homo sapiensradiation hybridNCBI RH14148.2 crSHGC-4864

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID47985
Probe Cross-refcontext specific help for: Probe Cross-refGDB:198723
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk