Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012734005

Eukaryota (3 taxa) STS probe D11S813E for H19, imprinted maternally expressed transcript (non-protein coding) (H19) and 2 more genes

Synopsis

Field NameValues
NameD11S813E
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pongo abelii
Target genesLOC100452997 (Pongo abelii); LOC100584817 (Nomascus leucogenys); H19 (Macaca mulatta)

Sequences

>Probe|12734005|PRIMERF Forward PCR primer (outermost) (20b)
TACAACCACTGCACTACCTG
>Probe|12734005|PRIMERR Reverse PCR primer (outermost) (18b)
TCGGAGCTTCCAGACTAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:583908
UniSTS IDcontext specific help for: UniSTS ID473360
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk