Display Settings:

Format

Send to:

Choose Destination
Pr012733690

STS probe D2S246E for endothelial PAS domain protein 1 (EPAS1) and 3 more genes

Synopsis

Field NameValues
NameD2S246E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEPAS1; EPAS1; EPAS1; EPAS1
UniSTS IDUniSTS:473077

Sequences

>Probe|12733690|PRIMERF Forward PCR primer (outermost) (20b)
GGCAGAACTTGAAGGGTTAC
>Probe|12733690|PRIMERR Reverse PCR primer (outermost) (20b)
TCGTTACGTTGACAGGTAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S246E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID473077
Probe Cross-refcontext specific help for: Probe Cross-refGDB:198907
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk