Display Settings:

Format

Send to:

Choose Destination
Pr012731073

STS probe RSA001259893 for eukaryotic translation initiation factor 2B subunit delta (EIF2B4)

Synopsis

Field NameValues
NameRSA001259893
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneEIF2B4
UniSTS IDUniSTS:470660

Sequences

>Probe|12731073|PRIMERF Forward PCR primer (outermost) (20b)
AAAGATTGGGCGAGCTGGGA
>Probe|12731073|PRIMERR Reverse PCR primer (outermost) (25b)
TGAACCCAAGGCAGAACTGTAGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmRSA001259893

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID470660
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center