Display Settings:

Format

Send to:

Choose Destination
Pr012729415

STS probe D5S470 for synaptopodin (SYNPO) and 3 more genes

Synopsis

Field NameValues
NameD5S470
Aliases144ZH4; AFM144zh4; HS144ZH4; RH42123
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSYNPO; SYNPO; SYNPO; SYNPO
UniSTS IDUniSTS:46914

Sequences

>Probe|12729415|PRIMERF Forward PCR primer (outermost) (20b)
GCAATCCACAAACGTCAAAA
>Probe|12729415|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGCCAGACTCCAGACAGC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S470
Homo sapienslinkageMarshfield5153.17 cmAFM144zh4
Homo sapienslinkageGenethon5152.8 cmAFM144zh4

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID46914
Probe Cross-refcontext specific help for: Probe Cross-refGDB:189350
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk