Display Settings:

Format

Send to:

Choose Destination
Pr012726816

Homo sapiens STS probe D15S959

Synopsis

Field NameValues
NameD15S959
AliasesRH31911; SHGC-2417
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:4668

Sequences

>Probe|12726816|PRIMERF Forward PCR primer (outermost) (22b)
AAGGCTCTTTCCAAGTGAGGTG
>Probe|12726816|PRIMERR Reverse PCR primer (outermost) (23b)
CCATTGCTGGCAGCATGAGACAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3152294 cr10000SHGC-2417
Homo sapiensradiation hybridNCBI RH15404.6 crSHGC-2417

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID4668
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center