Display Settings:

Format

Send to:

Choose Destination
Pr012724667

STS probe SHGC-52138 for potassium channel, inwardly rectifying subfamily J, member 6 (KCNJ6) and 4 more genes

Synopsis

Field NameValues
NameSHGC-52138
AliasRH43956
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesKCNJ6; KCNJ6; KCNJ6; KCNJ6; KCNJ6
UniSTS IDUniSTS:46486

Sequences

>Probe|12724667|PRIMERF Forward PCR primer (outermost) (24b)
GATTTTACCTGGGATATGACAAGC
>Probe|12724667|PRIMERR Reverse PCR primer (outermost) (19b)
TGTCTTCAGCTCACCTGGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map21 cmSHGC-52138

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID46486
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk