Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012724556

Eukaryota (3 taxa) STS probe D5S1987 for catenin (cadherin-associated protein), delta 2 (CTNND2) and 2 more genes

Synopsis

Field NameValues
NameD5S1987
AliasesAFMA240XF9; AFMa240xf9; HSA240XF9; RH30897; SHGC-20250
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesCTNND2 (Pongo abelii); CTNND2 (Homo sapiens); CTNND2 (Pan troglodytes)

Sequences

>Probe|12724556|PRIMERF Forward PCR primer (outermost) (25b)
GATTTGTCACTGATGACTAGGAAGG
>Probe|12724556|PRIMERR Reverse PCR primer (outermost) (23b)
GAATCACTTGAATCCAGGAGATG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G35525 cr10000SHGC-20250
Homo sapiensradiation hybridGeneMap99-G35525 cr10000AFMa240xf9
Homo sapienslinkageRutgers Map5 cmD5S1987
Homo sapienslinkageMarshfield522.34 cmAFMa240xf9
Homo sapienslinkageGenethon521.9 cmAFMa240xf9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID46476
Probe Cross-refcontext specific help for: Probe Cross-refGDB:607926
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk