Display Settings:

Format

Send to:

Choose Destination
Pr012724448

STS probe Cyp17a1 for cytochrome P450, family 17, subfamily a, polypeptide 1 (Cyp17a1) and 1 more gene

Synopsis

Field NameValues
NameCyp17a1
AliasUniSTS:464662
TypeSTS
Application
Source organism
Source sequence
Target genesCyp17a1; Cyp17a1
UniSTS IDUniSTS:464662

Sequences

>Probe|12724448|PRIMERF Forward PCR primer (outermost) (22b)
CTCCAGCCTGACAGACATTCTG
>Probe|12724448|PRIMERR Reverse PCR primer (outermost) (20b)
TCTCCCACCGTGACAAGGAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk