Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012723496

Eukaryota (4 taxa) STS probe UniSTS:463803 for procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1) and 3 more genes

Synopsis

Field NameValues
NameUniSTS:463803
AliasesPLOD__5723
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesPLOD1 (Pongo abelii); PLOD1 (Nomascus leucogenys); PLOD1 (Pan troglodytes); PLOD1 (Macaca mulatta)

Sequences

>Probe|12723496|PRIMERF Forward PCR primer (outermost) (19b)
CTCTTGGACCTTTCTTCTT
>Probe|12723496|PRIMERR Reverse PCR primer (outermost) (23b)
AAATGACCTTTAATAGAAACTCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmUniSTS:463803

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID463803
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk