Display Settings:

Format

Send to:

Choose Destination
Pr012723340

Eukaryota (3 taxa) STS probe UniSTS:463663 for optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) (OPA3) and 4 more genes

Synopsis

Field NameValues
NameUniSTS:463663
AliasesOPA3__6115
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100428395 (Macaca mulatta); LOC100431234 (Pongo abelii); LOC100461332 (Pongo abelii); OPA3 (Pan troglodytes); OPA3 (Macaca mulatta)
UniSTS IDUniSTS:463663

Sequences

>Probe|12723340|PRIMERF Forward PCR primer (outermost) (22b)
CTGATCAGTGTTAACCTTTACT
>Probe|12723340|PRIMERR Reverse PCR primer (outermost) (18b)
GGGTTTCATCATATTGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map19 cmUniSTS:463663

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID463663
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk