Display Settings:

Format

Send to:

Choose Destination
Pr012722265

STS probe Rara

Synopsis

Field NameValues
NameRara
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:462696

Sequences

>Probe|12722265|PRIMERF Forward PCR primer (outermost) (21b)
CAAGTAGAAGCCAGGAAAGTC
>Probe|12722265|PRIMERR Reverse PCR primer (outermost) (19b)
TGTAGCTCTCTGAGCACTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:3052931
UniSTS IDcontext specific help for: UniSTS ID462696
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk