Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012721760

Pongo abelii STS probe UniSTS:462240 for hemochromatosis (HFE) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:462240
AliasesHFE_3382
TypeSTS
Application
Source organism
Source sequence
Target organismsPongo abelii; Homo sapiens
Target genesHFE (Pongo abelii); LOC100438251 (Pongo abelii)

Sequences

>Probe|12721760|PRIMERF Forward PCR primer (outermost) (21b)
ATGTCATTTCATTTCCTATTT
>Probe|12721760|PRIMERR Reverse PCR primer (outermost) (21b)
CCTACTTCACTTTCTTCATTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmUniSTS:462240

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID462240
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk