Display Settings:

Format

Send to:

Choose Destination
Pr012721236

STS probe D17S1806 for RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3) and 3 more genes

Synopsis

Field NameValues
NameD17S1806
AliasesAFMA238YB5; AFMa238yb5; HSA238YB5
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100130312; LOC100133332; RBFOX3; RBFOX3
UniSTS IDUniSTS:46177

Sequences

>Probe|12721236|PRIMERF Forward PCR primer (outermost) (22b)
GATGTGCTTATTTGAAACCTGC
>Probe|12721236|PRIMERR Reverse PCR primer (outermost) (20b)
TGTAACGTCCACCAGCAGAG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S1806
Homo sapienslinkageMarshfield17114.41 cmAFMa238yb5
Homo sapienslinkageGenethon17115.4 cmAFMa238yb5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID46177
Probe Cross-refcontext specific help for: Probe Cross-refGDB:607848
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk