Display Settings:

Format

Send to:

Choose Destination
Pr012716937

STS probe stSG627885 for stereocilin pseudogene 1 (STRCP1) and 8 more genes

Synopsis

Field NameValues
NamestSG627885
TypeSTS
Application
Source organism
Source sequence
Target genesSTRC; LOC100434832; STRC; STRC; STRCP1; LOC649989; STRC; LOC731396; LOC749494
UniSTS IDUniSTS:457898

Sequences

>Probe|12716937|PRIMERF Forward PCR primer (outermost) (20b)
CCATCTCAGCAATCTGGGTT
>Probe|12716937|PRIMERR Reverse PCR primer (outermost) (20b)
TGAGGCAATTTCCTTGATCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID457898
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk