Display Settings:

Format

Send to:

Choose Destination
Pr012715685

STS probe G28262 for gamma-glutamyl carboxylase (GGCX) and 2 more genes

Synopsis

Field NameValues
NameG28262
AliasesSHGC-34342
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100510047; GGCX; GGCX
UniSTS IDUniSTS:45677

Sequences

>Probe|12715685|PRIMERF Forward PCR primer (outermost) (20b)
GATCGAGCCACTGCACTCCT
>Probe|12715685|PRIMERR Reverse PCR primer (outermost) (19b)
ACGCGGTGTGTTGCACATA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmG28262

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID45677
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk