Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012713397

Pan troglodytes and Homo sapiens STS probe DXS7278 for olfactory receptor, family 5, subfamily BH, member 1 pseudogene (OR5BH1P) and 1 more gene

Synopsis

Field NameValues
NameDXS7278
AliasesHUMSWX1077; sWXD1077
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesLOC743834 (Pan troglodytes); OR5BH1P (Homo sapiens)

Sequences

>Probe|12713397|PRIMERF Forward PCR primer (outermost) (19b)
GATCACCTCCCGATCTTGG
>Probe|12713397|PRIMERR Reverse PCR primer (outermost) (21b)
CATGTAGGAGACAAGGATCAC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7278
Homo sapiensphysicalWUSTL-XX0.3 ordinalsWXD1077

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID45471
Probe Cross-refcontext specific help for: Probe Cross-refGDB:556110
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk