Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012708791

Eukaryota (4 taxa) STS probe D6S1448 for dermatan sulfate epimerase (DSE) and 3 more genes

Synopsis

Field NameValues
NameD6S1448
AliasesHALD39H3; MR4415; RH37120; WI-3440; stSG6136
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesDSE (Pongo abelii); DSE (Homo sapiens); DSE (Pan troglodytes); DSE (Macaca mulatta)

Sequences

>Probe|12708791|PRIMERF Forward PCR primer (outermost) (20b)
GAGTGAGGGGGAAGGGTAAG
>Probe|12708791|PRIMERR Reverse PCR primer (outermost) (19b)
AAACATGTGGAGCCACAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmD6S1448

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID45056
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588815
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk