Display Settings:

Format

Send to:

Choose Destination
Pr012703996

STS probe D6S2202 for major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1) and 18 more genes

Synopsis

Field NameValues
NameD6S2202
AliasesSHGC-16855
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100133583; LOC100172120; LOC100293977; LOC100294132; LOC100294259; LOC100294318; LOC100457574; LOC100507687; LOC100507710; LOC100507719; LOC100510517; LOC100510688; LOC100510689; LOC100602317More
UniSTS IDUniSTS:44624

Sequences

>Probe|12703996|PRIMERF Forward PCR primer (outermost) (25b)
GAGGAGAGAATAGAAACAGAAACCC
>Probe|12703996|PRIMERR Reverse PCR primer (outermost) (20b)
TCATCTCCTTTCATCCCCAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmD6S2202

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID44624
Probe Cross-refcontext specific help for: Probe Cross-refGDB:741212
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk