Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012699597

Eukaryota (3 taxa) STS probe D1S432 for rhomboid, veinlet-like 2 (Drosophila) (RHBDL2) and 2 more genes

Synopsis

Field NameValues
NameD1S432
AliasesAFM214yc7; RH33755; SHGC-3637
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Homo sapiens
Target genesRHBDL2 (Pan troglodytes); RHBDL2 (Homo sapiens); LOC715695 (Macaca mulatta)

Sequences

>Probe|12699597|PRIMERF Forward PCR primer (outermost) (19b)
GAGATTGCACCACTGCACC
>Probe|12699597|PRIMERR Reverse PCR primer (outermost) (20b)
CGCAGACAACTCTTTTTTTC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G311965 cr10000SHGC-3637
Homo sapiensradiation hybridGeneMap99-G312235 cr10000AFM214yc7
Homo sapienslinkageRutgers Map1 cmD1S432
Homo sapiensradiation hybridNCBI RH1251.9 crSHGC-3637

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID44228
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk