Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012698499

Pan troglodytes and Pongo abelii STS probe REN116496 for H19, imprinted maternally expressed transcript (non-protein coding) (H19) and 1 more gene

Synopsis

Field NameValues
NameREN116496
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100452997 (Pongo abelii); H19 (Pan troglodytes)

Sequences

>Probe|12698499|PRIMERF Forward PCR primer (outermost) (24b)
GAGGTCTGGTTCCTCTAGCTTCAC
>Probe|12698499|PRIMERR Reverse PCR primer (outermost) (23b)
ACAGAAATGGTGCTACCCAGCTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmREN116496

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID441291
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk